Nucleotide sequence of a human 5S rRNA gene.
نویسندگان
چکیده
A gene for human 5S rRNA has been cloned and sequenced. The gene was isolated on a 638 bp fragment (Fig. 1) from human placenta DNA by digestion with BamHI and Sad and cloning into a Bluescnpt M13 plasmid. A ^P-labelled SP6-transcript of a mouse pseudogene was used as a probe. The fragment has a restriction pattern identical to the pattern of the majority of human 5S rRNA genes, which are found in tandem repeats of 2.3 kb (unpublished results). The gene is transcribed in a HeLa cell extract. Comparative sequence analysis reveals only limited homologies to flanking regions of other eucaryotic 5S rRNA genes In Fig. 2 is shown the comparison to position 1 to 6 0 of a hamster 5S rRNA gene (1) and the Xenopus laevis somatic and oocyte 5S rRNA genes (2, 3) The A and G at positions 1 5 and —14, which are conserved between human and Xenopus, is part of a Xenopus element suggested to bind an upstream stimulatory factor (4). ACKNOWLEDGEMENTS
منابع مشابه
Nucleotide sequence of the 5S ribosomal RNA gene of Bartonella bacilliformis.
Eubacterial rRNA genes are usually organized in opeirons containing the 16S, 23S and 5S rRNA genes, in that order (I). A cluster of structural rRNA genes was discovered during nucleotide sequencing of a cloned 3.6-kb BamiiHI fragment of DNA from B. bacillifornis, the agent of Oroya fever in humans. The 5S rRNA gene is 119 bp in length and is located 107 bases 3' to the 23S rRNA gene of the bact...
متن کاملNucleotide Sequence Analysis of the 5S Ribosomal RNA Gene of the Mushroom Tricholoma matsutake
From a cluster of structural rRNA genes which has previously been cloned (Hwang and Kim, in submiddion; J. Microbiol Biotechnol.), a 1.0-kb EcoRI fragment of DNA which shows significant homology to the 25S and 5S rRNAs of Tricholoma matsutake was used for sequence analysis. Nucleotide sequence was biditectionally determined using deletion series of the DNA fragment. Comparing the resultant 1016...
متن کاملThe nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
متن کاملIsolation and characterization of the 5S rRNA gene of Leptospira interrogans.
The gene encoding the 5S rRNA for Leptospira interrogans serovar canicola strain Moulton was isolated and sequenced. The 5S rRNA gene occurs as a single copy within the genome and encodes a 117-nucleotide-long RNA molecule. The 5S rRNA gene is flanked at both the 5' and 3' ends by regions of A + T-rich sequences, and the 5'-flanking region contains a promoter sequence. L. interrogans has a uniq...
متن کاملLinking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throu...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
- Nucleic acids research
دوره 18 10 شماره
صفحات -
تاریخ انتشار 1990